Essay on Assess and Outline Analytical Behaviourism

Analytical Behaviourism is an empiricist view that was popular in the 1950s, and 60s. It was regarded as a scientific study of the mind, unlike psychological behaviourism. Popular behaviourists include Tom Nagel, Hempel and Ryle. Behaviourists believe that every time we talk about the mind we are infact talking about either actual, or possible, behaviour. So we are speaking about just physical substances and attributes, and nothing non-physical. Behaviourists reject the existence of mental states `sui generis, (as something in their own right). As behaviourism is all to do with the physical, behaviourism is a form of materialism. It claims to solve the mind and body problem, aswell as the problem of other minds, solipsism.†¦show more content†¦Each of us has a concept of anger as an emotional state, not as a behaviourist state, so it seems to make sense that anger is not purely a behaviourist state, but is most definitely also what we feel it to be, and how we experie nce it. Behaviourism also seems to confuse what identifies mentality with what mentality actually is, for example Litmus paper identifies acids from alkalis, but is not the difference between them, in the same way that certain behaviour can identify certain ways we must feel, but is not the be all and end all of who we are. If behaviour is caused by mental states, which it does appear to be, then surely we have two entities and not one? Behaviourism seems to ignore this, but it is a problem because something cannot cause itself, but must be caused by something separate. There must be at least two entities, in order for there to be cause and effect. Another criticism of behaviourism is that we could never learn words which refer to how we feel, for example anger, if we did not know what it was in our mind. We can refer to anger, fear, excitement, etc because we have experience of what these feel like, we do not only simply visualise the behaviour associated with these feelings in order to understand them, we also remember what thisShow MoreRelatedConflict Management and Emotional Intelligence63003 Words   |  253 Pages      1   1.2 Research  issues  and  contributions        Ã‚  Ã‚        Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚      4   1.3 Justification  for  the  research        Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚                  6   1.4 Research Method           Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚         1.5 Outline  of  the  dissertation                                                                  11   1.6 Definitions  of  Terms                    Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚  Ã‚   12   1.7 Delimitations  of  scope  and  key  assumptions              Ã‚  Ã‚  Ã‚  Ã‚   16

Zara Fashion Chain Linked with Slave Labor in Brazil, From Pit to Port Literature review

Essays on Zara Fashion Chain Linked with Slave Labor in Brazil, From Pit to Port - Indias $10 Billion Coal Export Plan, Bumpy Ride on the Shrinking Kangaroo Literature review The paper â€Å"Zara Fashion Chain Linked with Slave Labor in Brazil, From Pit to Port - India’s $10 Billion Coal Export Plan, Bumpy Ride on the Shrinking Kangaroo" is thrilling  literature review on social science. The fashion chain Zara is implicated in being associated with slave labor mostly by having workers perform their duties in unhealthy and dangerous work stations and also through outsourcing workers illegally with an intention of overworking then for own benefits.IssueZara fashion shop has been operational in Brazil. However, it was noted that the company was not responsible for its employees. Through the investigations carried, workers worked for very long shifts and unfavorable conditions Mr. Bignami stated that the economic turmoil in Spain has forced large numbers of people to migrate to Brazil.ImplicationsInditex, Zara’s parent company was not to blame for the unauthorized outsourcing of workers from Bolivia and Peru. This is tarnishing the reputation of the firm which can impact negatively its market share whereby its customers may take it as a company that is out to exploit others.After it was noted that working conditions in this shop are unfavorable, the ministry of labor demanded an explanation and change must be effected towards improving the same. The hour's workers take in the working place are very many hours. Increasing the number of employees so that they can work in shift and recommended hours is an option. This will, in the long run, mean that the expenditure of the firm will increase as a result of increasing workers.Article two"From pit to port: India’s $10 billion coal export plan" The Australian National affairs, 20th August 2011.SummarizeAdani Enterprises in an Indian energy giant that has developed a big mine in the Galilee Basin. It seeks to control whatever component coal touches from the railway line to the ports and this brew up some heated arguments from coal seam gas developers and farmers about t he land ownership. This control is aimed at making sure that the supplies of coal arrive at the destined locations as planned and in time.IssueAdani enterprises are out to make several developments in Queensland with the intention of having coal exports to India for sustainable growth. The company is well equipped and has diverse strategies to put them a level higher than the other companies.It is also worth noting that this company is headed by a university dropout who is a 41-year-old Gautam Adani which means that, the strategies and the innovation applied in the company are far above any educational qualification if at all this company is competing with other firms headed by well-educated people.ImplicationsWith this company in the market, there are many improvements that are going to be experienced in Australia. First, the railway line and the ports will have to be improved so that the transport of coal is easier. Agriculture as said to be the main activity is also going to bene fit through railway and ports in the case of imports and exports. As stated by Mr. Derasari, there is a need for a new port, and Adani will do the construction and there is also a proposal for two new train lines.

Business Performance of Ecommerce Applications †MyAssignmenthelp

Question: Discuss about the Business Performance of Ecommerce Applications. Answer: Introduction Ecommerce business involves the selling and buying of services or goods or the transmission of funds with the help of an electronic network. There are three types of ecommerce business which includes, business-to-consumer, business-to-business or consumer-to-business. This report is based on the plan of an ecommerce website which is built on the concept of business-to-consumer style of website. The analysis in this report is based on the formation of a business plan for incorporating an ecommerce business in Saudi Arabia (Akazue, Aghaulor and Ajenaghughrure 2015). Lot of hard work is required to start up a new ecommerce business as it requires a lot research work and many complicated processes are involved in the process of opening a new business. The ecommerce business which is being started in Saudi Arabia is named Goldengate.com. The products offered by Goldengate.com will include a wide variety of fashion apparels, household items, kids products, beauty products, electronics and mobile phone related products. The fashion apparel category includes, clothing for men and women, shoes, jewellery, bags and luggage items. The product range will include books, tablets, laptops, computers, mobile accessories, movies and mobile games, computer accessories, musical instruments, office stationaries, school stationaries and many more (Balaraman and Kosalram 2012). The other products include home and kitchen supplies, pet supplies, grocery products for suitable locations, car accessories, appliances required for personal care, diet products. Electronic and large products will also be available in the website. These include, TVs, refrigerators, washing machines, cameras, air conditioners. The website will offer free delivery services to the customers who shop for a minimum of 30 riyals. The other services that will be offered in the website will include the different payment modes like, cash on delivery, card payment and payment through any other type of payment gateways. The website will also offer a membership to the customers for a fee 50 riyals per year which is named the Goldengate Royals. The customers who are members of this club will be offered free deliveries for any amount of money and faster deliveries are also offered. The Goldengate Royals will have the facility to get access to many deals and offers related to the products of the website (Doloto and Chen-Burger 2015). The website will provide online videos and movies free for the members for the first six months of the membership. This is the inaugural offer of the company. The website is attached with an electronic wallet which is named Goldengate quickpay. This electronic wallet can be used by the memb ers as well as the normal customers to make payments for their purchases. The purchases made by paying through the electronic wallet of the website will be discounted at a rate of 10% (Ghandour 2015). Statement of the vision The vision statement of the company states that Our vision is to build an easy to use and customer friendly company, where the customer can find anything they wish to own in an easy and convenient manner. The vision of the company is to build an easy to use environment for the customers, so that the customers can get accustomed with the website within a short period. The company will aim at making each and every good available for the customers, so that they can get what they under the same platform (Giri 2016). The website will be designed in such a way that the customers can search for their choice of products or services within moments and the products will get delivered to the customers once ordered. The website of Goldengate will be interactive in nature and the customers will get all possible help from the customer service executives of the company. In this manner the company aims at building a strong liaison with the customers and thereby creating a loyal customer base (Jiwnani and Tanwar 2015). A start-up ecommerce business involves many steps and processes as explained further. The products that are to be showcased and sold on the website are selected based on the needs and desires of the customers. The selection of the correct products is the most challenging part of the commencement of the business. The products of the website are selected based on other factors which includes the trends in the market and requirements of the customers according to that. The ways of selecting the right products include, building a brand which is interesting, identification of the passion of the customers, looking for opportunities and trends in the market (King et al. 2012). After the selection of the products the next step involves the evaluation of the decision taken regarding the product selection and checking the viability of the products as well. The next step in the process involves obtaining the selected products from the market, by contacting the suppliers or the manufacturers of the products. The products need to be sourced safely from trusted manufacturers and suppliers, so that the best is delivered to the customers. The competition in the market related to ecommerce business needs to be researched in the next step and the business plan is prepared for the website (Kumar and Raheja 2012). The business plan is the most vital part of the whole business process, as this plan will decide the success of failure of the business. The next step that is taken is to register the business with the name Goldengate.com and incorporate it. The costs related to the registration of the business can be huge. The next step is taken to create the logo of Goldengate.com and incorporate the logo. This step is followed by the optimization of the website with the search engines like Google to start the website or the online store (Lixandroiu and Maican 2015). SWOT analysis of the business Strengths of Goldengate.com The strengths of Goldengate.com include the products and service offerings of the website. The variability of the products and services of Goldengate.com in larger than the other websites that operate in Saudi Arabia like, Souq.com, Wadi.com, Namshi.com. The concept and the look of the website will be new and innovative as well. The services offered by Goldengate.com that include electronic wallets, membership offers are capable of attracting more customers towards the website (Muntjir and Siddiqui 2016). Weaknesses of Goldengate.com Goldengate.com is a start-up business and this can act as a weakness of the company. The company is new to the business and making the tie-ups with the suppliers regarding the supply of the products can act as a barrier as the other competitors of the company are also there in the market. The other weakness is the process of building the trust of the competitors towards the business and gaining loyal customers (Niranjanamurthy et al. 2013). Opportunities of Goldengate.com Goldengate.com has huge opportunities in the ecommerce market, as this a growing sector and the customers of the online sector are increasing day by day. The customers are turning more towards the online sector as compared to the offline marketing sector. Goldengate.com has the ability grow in the market and pose threats towards its competitors. Threats towards Goldengate.com The threats to Goldengate.com include the competition that is posed by the other ecommerce websites that are already operating in Saudi Arabia. The companies are in the market for quite a long time and their experience in the market acts as a threat (Peliknov 2013). The website of Goldengate.com will have many functions which includes the menu and the categories of the products, the services offered to the customers, the ways by which the customers can contact the officials of the company. The website functions need to include the description about the available products, for example the prices of the products, the details of the products. The customers will be able to contact with the executives of the company as and when any type of help is required (Rawat and Divekar 2014). Menu of the products The products will be divided into different categories as per their relevance. The different categories of products will include, Appliances and Electronic products, Kitchen and home products, Mens fashion products which will include clothing, shoes and bags, Womens fashion products including clothing, shoes, bags, jewellery and fashion accessories. The other categories include healthcare and beauty products for men and women, sports products, books and movies, accessories for cars and motorbikes. The services of the website will include, the membership plan for Goldengate.com named Goldengate Royals, the registration for the electronic wallet option of the website and the facility of free videos on the website (Singh 2012). The contact option in the website will include the ways by which the customers can contact the company. These ways include the email and call options to the connect with the customer care executives which will come under the Contact Us or Help options of the websites. The other ways by which the company can connect with the customers are the social media websites, including Facebook, Twitter and Instagram. The website will provide the links to these websites so that the customers can contact with the company and a loyal customer base can be built as well (Sohaib and Kang 2012). The software that is suitable for Goldengate.com is the Ability Commerce software, which helps in the incorporation of the system of order management and the system of accounting. This platform includes a content manager named SmartSite which helps the users to store the images, prices and the promotions regarding the products within the Web store. The other software that is suitable for launching an ecommerce website is Intuit Ecommerce and it mainly offers a simple interface which facilitates the design and launch of the online store. The Intuit Ecommerce software also provides facilities related to the link to the social media websites like Facebook, Twitter, Instagram. The business page of Goldengate.com in Facebook and the other social media will be linked with the help of this software (Spencer, Harding and Sheahan 2014). The above discussed software will be used in the creation and development of Goldengate.com. Functions required in the website The functions that will be provided in the website include the category of the products and the information and details regarding the product. The customer support function is also provided in the website. The information regarding the company is provided in the website. The payment options, the membership plans are provided. The other important aspect that is addressed in the website is the return and replacement policy of the company and processes related to the return of the products or the replacement. The replacement policy is designed keeping in mind the requirements of the customers (Umberto 2015). The company will be registered with server where the website will be hosted. The web protocol will be assigned to Goldengate.com and the database of the company will be created and linked to the website. The next step is the formation and registration of the domain name of the company, that is, Goldengate.com. This step will complete the design of the online ecommerce website of Goldengate.com (Winter 2012). The security issues related to Goldengate.com include, the frauds related to online payments made through credit cards and debit cards or with the help of net banking facilities. The payments made through electronic wallets also poses security issues to the customers as well as the company. The hacking of the bank websites is a major threat in case of online payments. The customers are sometimes hesitant towards the online payment of products purchased from the ecommerce websites. This reduces the trust factor of the customers on the company and its operations. The website of the ecommerce company can get hacked and this can lead to huge problems for the customers. There are many ways by which a security can occur in case of any ecommerce website, in this case, Goldengates.com (Akazue, Aghaulor and Ajenaghughrure 2015). These ways include, the breach of a payment gateway, the computer of the customer can be infected, the software provider of the shopping website is not secure. Type of security required The security issues related to the website of Goldengate.com can be resolved with the help of the ways discussed further. The ecommerce platform of Goldengate.com should be chosen by checking the security of the platform, Goldengate.com has to use SSL or Secure Sockets Layer for authentication and protection of data. The sensitive data of the customers, for example, the records of the customers and the banking details should not be stored, a feature of verifying the address and the card of the customer should be included, the customers should use strong passwords. The security system of Goldengate.com should be layered in such a way so that it becomes difficult for the hackers to breach (Balaraman and Kosalram 2012). The threats that are posed towards the website includes the breach of security and theft of the information related to the customers, which will lead to the loss of customer base for Goldengate.com (Doloto and Chen-Burger 2015). The Goldengate.com website therefore needs to be created keeping in mind the various security issues and thereby taking measures to address these issues. Conclusion The report can be concluded by stating that the ecommerce website named Goldengate.com that is created for Saudi Arabia, has to be incorporated by keeping in mind the various issues related to the ecommerce business. The process of incorporation of an online business is complicated and the security issues related to this business are also quite complicated. This will require intensive research and planning before starting the business in full form. References Akazue, M.I., Aghaulor, A. and Ajenaghughrure, B.I., 2015, January. Customer's protection in ecommerce transaction through identifying fake online stores. InProceedings of the International Conference on e-Learning, e-Business, Enterprise Information Systems, and e-Government (EEE)(p. 52). The Steering Committee of The World Congress in Computer Science, Computer Engineering and Applied Computing (WorldComp). Balaraman, P. and Kosalram, K., 2012. E-Commerce Evaluation and E Business Trends.International Journal of Information Engineering and Electronic Business,4(5), p.9. Doloto, U. and Chen-Burger, Y.H., 2015. A Survey of Business Models in eCommerce. InAgent and Multi-Agent Systems: Technologies and Applications(pp. 249-259). Springer, Cham. Ghandour, A., 2015. Ecommerce website value model for SMEs.International Journal of Electronic Commerce Studies,6(2), p.203. Giri, A.V., 2016. The role and impact of e-commerce on consumer behaviour.Economic and Social Development: Book of Proceedings, p.390. Jiwnani, G. and Tanwar, S., 2015. E-Commerce Using Public Key Infrastructure.International Journal of Advance Foundation and Research in Computer,1, pp.119-124. King, R.C., Sen, R., DAubeterre, F. and Sethi, V., 2012. A trade value perspective on ecommerce research: an integration of transaction value and transaction cost theories. InTransformations in E-Business Technologies and Commerce: Emerging Impacts(pp. 59-78). IGI Global. Kumar, V. and Raheja, E.G., 2012. Business to business (b2b) and business to consumer (b2c) management.International Journal of Computers Technology,3(3b), pp.447-451. Lixandroiu, R. and Maican, C., 2015. An Analysis On Choosing A Proper Ecommerce Platform.Risk in Contemporary Economy, pp.54-59. Muntjir, M. and Siddiqui, A.T., 2016. E-Commerce Framework Based on Evaluation of Data Mining and Cloud Computing.International Journal of Computer Science and Information Security,14(4), p.286. Niranjanamurthy, M., Kavyashree, N., Jagannath, S. and Chahar, D., 2013. Analysis of e-commerce and m-commerce: advantages, limitations and security issues.International Journal of Advanced Research in Computer and Communication Engineering,2(6). Peliknov, R.M., 2013. The (in) significance of domain names for ecommerce.ACC LiberecB Science of Economics,19(2), pp.40-52. Rawat, S. and Divekar, R., 2014. Developing a Social Media Presence Strategy for an E-commerce Business.Procedia Economics and Finance,11, pp.626-634. Singh, N., 2012. A component-based model for e-business, integrating knowledge management and e-commerce.Journal of Information and Operations Management,3(1), p.25. Sohaib, O. and Kang, K., 2012. The Effect of Technology, Human and Social Networks in Serviceable Cross-Culture Business to-Consumer (B2C) Websites.Journal of Internet and e-Business Studies,2012, p.1. Spencer, S., Harding, J. and Sheahan, J., 2014.Social eCommerce: Increasing Sales and Extending Brand Reach. " O'Reilly Media, Inc.". Umberto, P., 2015. Developing a price-sensitive recommender system to improve accuracy and business performance of ecommerce applications.International Journal of Electronic Commerce Studies,6(1), p.1. Winter, S.J., 2012. The rise of cyberinfrastructure and grand challenges for eCommerce.Information Systems and e-business Management,10(3), pp.279-293.

Software Reliability and Testing Requirement

Most software products require testing to determine their reliability. Some software products with certain inputs might fail to work. Testing enhances the capability determining the degree of defects. Measuring test runs also assist in determining quality. The non-functional requirement of a test is usually a binary and not just a single activity. As such, a software product may either fail or pass the test.Advertising We will write a custom essay sample on Software Reliability and Testing Requirement specifically for you for only $16.05 $11/page Learn More Failure of a software can be determined when the functionality of its program does not meet user requirements. On the other hand, passing a reliability test is the probability of the software to operate within a period of time without failure. It is important to highlight at this point that testing process runs through the life cycle of software development. Early testing is critical for finding defec ts, preventing malfunctions and providing information on quality levels. However, as the principle of pesticide paradox explains, a repeat of software tests lowers the potential of a testing activity especially when detecting a new bug. The probability of software to operate within a period of time without failure is a factor that contributes to reliability. Failure of the software can be determined when the functionality of its program is not in tandem with the tastes and preferences of users. Software quality represents an oriented view of a user on its dependability. Over the years, design has been used to measure the quality of a software product. This system involves counting faults present in a particular program. However, it has not been as effective as a developer oriented approach since it does not count faults. It rather relates to operations. The reliability of software does not change over time if not intentionally modified. However, software is not totally reliable due to various risks it poses to users. These risks come from faults and bugs. A bug in software may cause it not to work as expected and consequently result into accidents, delays on credit cards, losses and errors on bills. As such, software testing is critical in measuring quality and reducing risks. Achieving the reliability of software is very critical in any software industry. The height of complexity of the software makes it cumbersome to achieve the key task of reliability. The quality of software which is usually an attribute of reliability can be tested and measured. Particular software metrics may be applied at each development phase to improve quality. These include testing, coding, design and requirements.Advertising Looking for essay on programming? Let's see if we can help you! Get your first paper with 15% OFF Learn More Software testing is normally conducted for non-functional software requirements and functional attributes. Testing assists in assessing de fects and eventually improving the overall standard of a software product. A sufficiently rigorous test helps in uncovering defects. The development of quality software products can be increased by proper fixing. While testing assists in determining potential failures and faults, it is imperative to work around the failures bearing in mind that not all faults can be fixed. When a defect is being corrected, chances of it being done incorrectly as well as the introduction of a new defect are generally high. In addition, working under pressure limits the ability to remove a fault. It is advisable to avoid software problems by preventing failures, faults and errors. Testing is not a unilateral activity. It is a process that runs through the life cycle of a given product. Bugs are mostly found in the later stages of software life cycle. Designing and verifying test at the right time are vital measures in finding and fixing challenges posed by software development. For instance, the latte r procedures lower the overall cost of operations during all the developmental stages. When executing testing, it is imperative for a programmer to determine the ability of a software product to meet users’ requirements. This includes manual checking product specifications and executing code by reviewing its design. Besides, cross-examination of the software to ensure that it fits for its purpose. As indicated earlier, software should be able to work effectively according to the set tasks and equally meet the expectations of users. Moreover, testing also aids in detecting defects that trigger failures. A programmer is able to understand associated risks a defect can cause when software is in operation. This knowledge helps in improving the functionality of software. A root cause analysis aids in identifying defects. It limits making future errors and improves software development process. All types of testing are meant to identify defects. Software testing helps in removing d efects but cannot guarantee complete elimination of faults. Even so, an unusable system requires no fixing of defects. Clients who need fixing of defects only do so in the event that the software is unstable. Reviews and inspections are important so that clients’ software expectations are met.Advertising We will write a custom essay sample on Software Reliability and Testing Requirement specifically for you for only $16.05 $11/page Learn More It is impossible to exhaust a software test. The concern over of how much testing should be done is a life-long question. Many systems contain several outputs with valid numerical values. Pressure on time and cost limits the ability of a tester to exhaust the process. A level of risk including business and technical needs should be looked into. It is crucial to begin the process of software testing without much delay. The testing activities that entail both static and dynamic procedures should be guided by d efined objectives. Early testing is critical for finding and preventing defects and also offering information on quality levels. When the process of testing is begun at the right time, it allows programmers to identify and correct faults effectively. A pre-release testing gives defects. These defects are normally clustered due to knock-on faults that arise from changing software and complex codes. Their modules show operational failures. A review of the latter is important in improving development and design processes. To identify the cause of clusters, prevent failures, defects and future potential future clusters, early testing is paramount. A repeat of software tests has the capability of lowering the potential of a testing activity in detecting a new bug. Besides, a test should be done in one area of finding coding bugs and then moved to another area with a new set of risks. Activities involved in testing are not isolated. They are related to operations carried out in software d evelopment. A test must fit within the product life cycle in order to be efficient in meeting the needs of users. Both verification and validation testing should be used. Using the waterfall model, testing must be done on a set timeline. Testing is done at the end of a life cycle thus presenting the difficulty of obtaining feedback upwards. The V-model addresses traditional waterfall inefficiencies. Unlike the waterfall model, testing begins early in the V-model. Defects are identified earlier when reviewing requirements to the end where user acceptance testing is done. V-model has four levels of testing.Advertising Looking for essay on programming? Let's see if we can help you! Get your first paper with 15% OFF Learn More This essay on Software Reliability and Testing Requirement was written and submitted by user Alejandra Espinoza to help you with your own studies. You are free to use it for research and reference purposes in order to write your own paper; however, you must cite it accordingly. You can donate your paper here.

Violent Forms In Sociopolitical Spheres Understanding State Mass Kill Essay Example For Students

Violent Forms In Sociopolitical Spheres: Understanding State Mass Kill Essay ings In Indonesia 1965-66Violent Forms in Sociopolitical Spheres: Understanding State Mass Killings in Indonesia 1965-66 Amanda Maull2-04-01H.Schulte NordholtPolitical Violence in AsiaIn order to develop a general framework with which to understand collective political violence, I examine state mass killings in Indonesia 1965-66. While acknowledging the importance of historical/cultural factors, I identify elements within the sociopolitical sphere that influence actors of collective political violence at national, local, and event- specific levels. Elements discussed are elite interests, justification for violence, formal organizations, and mobilization factors. Finally, I suggest future preventative policy measures. IntroductionViolence marks much of human history. Within the sociopolitical sphere, violence has continually served as a tool used by various actors to influence and/or to control territory, people, institutions and other resources of society. The twentieth century witne ssed an evolution of political violence in form and in scope. Continuing into the twenty-first, advances in technology and social organization dramatically increase the potential destructiveness of violent tools. Western colonialism left a world filled with many heterogeneous nation-states. In virtually all these countries nationalist ideologies have combined with ethnic, religious, and/or class conflicts resulting in secessionist movements or other kinds of demands. Such conflicts present opportunities for various actors in struggles for wealth, power, and prestige on both national and local levels. This is particularly evident in Indonesia, a region of the world that has experienced many forms of political violence. The state mass killings of 1965-66 mark the most dramatic of such events within this region. My goal is to understand the killings within a framework of collective political violence. I consider actors and agencies at national, local and event-specific levels in order to understand the mobilization of actors. Within this framework, I determine the relative importance of historical/cultural factors, elite interests, justifications for violence, organization and individual perceptions. Finally, I present questions for future research and preventative policy options. We will write a custom essay on Violent Forms In Sociopolitical Spheres: Understanding State Mass Kill specifically for you for only $16.38 $13.9/page Order now Common explanations of political violence in Indonesia focus on local culture, the legacies of colonialism, and the social conflicts through which violence manifests. Often, observers describe such events as spontaneous and uncontrollable. One obtains the impression that riots are explosions of latent tensions and mass killings, unstoppable runaway trains. However such explanations are at best incomplete and significantly obscure important variables. Mass collective violence is rarely spontaneous. Elite interests, formal organizations and actors at various levels interact to create violent 1outcomes. I consider such interactions surrounding the state mass killings in Indonesia 1965-66. The Frames of Violent Forms Defined generally as â€Å"the use of physical force or coercion, used with the intention of bringing harm to others (and their material goods), which is linked to a struggle for power†, political violence make take on numerous forms. Such forms are characterized by varying elements of intensity, destructiveness, and duration. It is not my intention to provide a general descriptive theory of political violence. Given the varied nature of political violence and the compounding complexities of unique circumstance, an attempt at such a mega-theory would over-generalize in the search for ideal types and remain inapplicable to real situations. However, some forms of collective political violence possess common elements. This suggests the possibility of a general framework for understanding collective political violence. Understanding the similarities and differences between forms of collective violence would aid efforts at preventive policies. To begin c reating a general frame, I analyze state mass killings in Indonesia 1965-66. Specific forms of collective political violence present many superficial differences and few similarities. State mass killings are methodical, wider in scope and more violent. Contained to specific regions, endemic communal violence, in the form of riots, pogroms, and massacres seem sporadic and spontaneous. However, both types of collective violence require some level of organization. Though not perfectly continuous, both are maintained over periods of time. Similarly, they must be analyzed combining different interactive levels: national, local, and event-specific. I begin with one form and consider the interaction of the following elements across levels: elite interests, justifications for violence, organization, and mobilization of individual actors. This is done within a conceptual framework, which also recognizes the historical circumstances of location. 2Indonesia’s cultural and colonial histories have uniquely affected its modern sociopolitical spheres. An immense arch ipelago, few unifying â€Å"Indonesian† characteristics exists as there are many cultural differences among the islands. However, a common pre-colonial history marked for all the uncertainties of disease, failed harvests, natural disasters, and shifting power relations within ruling dynasties. Though competitive and conflictive, the pre-colonial royalty â€Å"was based on the notion that the control of violence was more important than the actual implementation of it, because there was a strong belief that violence could easily result in total destruction†. Dutch colonial rule differed greatly. Distrustful of its subjects, the colonial government ruled by violence and fear. Post-colonial Indonesia has inherited this ‘state of violence’. Colonial authorities relied on criminal gangs to maintain order. In more destructive forms, crime remains as part of the state. Concentrated in the center, power remains corrupt and self-serving. Today, Indonesia contains many different ethnic groups and is a highly stratified and internally conflicted society. Colonialism produced export-oriented economies, organized by business class minorities. Independence created a ‘nation’ not on the basis of a society unified culturally but on one unified by colonial rule. The resulting, social conflicts feed contests for political power. In fact for many postcolonial countries, the western concept of a territorially defined nation-state has lead to â€Å"struggles among competing elites and counterelites for control over the state apparatus †¦ as well as to local struggles for power, wealth, and safety†. Violence is an integral part of such struggles. The pragmatic objective of political violence is power. Subsequently, many different types of elites may use, condone, or tolerate violence when it serves their interests. National and local interests intentionally use collective political violence in struggles for wealth, power, and prestige. Further, powerful extra-national parties may quietly sanction or actively support such violence. While the nature and interests of supra-national, national, and local elites may vary, I show that their involvement whether 3direct or indirect is instrumental for at least one form of collective political violence. Violent action requires justification. Elites and organized leaders must gain some measure of support for their decisions; individuals must rationalize violent deviations from social obligation not only to their communities but also to themselves. Often, the ideology of the nation-state provides â€Å"sufficient justification for both state-directed and state-supported violence as well as organized and preplanned intercommunal and interethnic violence†. Perceived threats to the integrity of the nation serve to consolidate imagined internal unity, while justifying state-directed and communal collective violence against targeted populations. These populations become scapegoats for all kinds of social ills. Displacing blame on to the victim, state and local elites along with individual actors attempt to escape legal and moral responsibility for their actions. Further, elites and individuals use methods of moral exclusion to justify violent actions. Using religious doctrines and o ther ideologies, the targeted population is removed from the perpetrator’s world of social obligations. In this way, otherwise unthinkable actions are accepted by society. I examine the types of justifications used by various actors within the state mass killings of Indonesia. .u47b101419a3980ea4d4ad7422ef5d792 , .u47b101419a3980ea4d4ad7422ef5d792 .postImageUrl , .u47b101419a3980ea4d4ad7422ef5d792 .centered-text-area { min-height: 80px; position: relative; } .u47b101419a3980ea4d4ad7422ef5d792 , .u47b101419a3980ea4d4ad7422ef5d792:hover , .u47b101419a3980ea4d4ad7422ef5d792:visited , .u47b101419a3980ea4d4ad7422ef5d792:active { border:0!important; } .u47b101419a3980ea4d4ad7422ef5d792 .clearfix:after { content: ""; display: table; clear: both; } .u47b101419a3980ea4d4ad7422ef5d792 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .u47b101419a3980ea4d4ad7422ef5d792:active , .u47b101419a3980ea4d4ad7422ef5d792:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .u47b101419a3980ea4d4ad7422ef5d792 .centered-text-area { width: 100%; position: relative ; } .u47b101419a3980ea4d4ad7422ef5d792 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .u47b101419a3980ea4d4ad7422ef5d792 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .u47b101419a3980ea4d4ad7422ef5d792 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .u47b101419a3980ea4d4ad7422ef5d792:hover .ctaButton { background-color: #34495E!important; } .u47b101419a3980ea4d4ad7422ef5d792 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .u47b101419a3980ea4d4ad7422ef5d792 .u47b101419a3980ea4d4ad7422ef5d792-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .u47b101419a3980ea4d4ad7422ef5d792:after { content: ""; display: block; clear: both; } READ: Anarchist Utopia EssayAnother important aspect of collective political violence is the involvement of formal organizations. Organizations are necessary for almost all types of enduring collective activity. Often portrayed as spontaneous, collective political violence is most often instigated by various organizations. Whether based on religious doctrine or other ideologies, organizations of some type play a crucial role in the mobilization of actors and the coordination of collective political violence. They provide essential weapons, which national and local elites utilize in power struggles. Youth organizations are particularly common actors in collective violence. . When discussing mobilization, I will expand on the dynamics of youthful peer groups. 4The level of organization and the nature of formal groups may vary across types of collective violence. State-mass killings require the direct involvement of the military. The military may completely control the violence or it may enlist the participation of other organizations at the local level. Communal violence predominantly involves local organizations. In some cases, the military may indirectly support violence, through inaction or the provision of arms. However, their direct involvement is usually limited to controlling communal violence, though their efforts may be weak or purposely ineffectual. Analyzing state mass killings, I examine the varied types of formal organizations and their roles in the coordination and mobilization. Finally, the mobilization of individual actors incorporates some aspects previously discussed. As well, many other processes relate to the participation of individual actors in collective political violence. Some of these processes are explained by theories of relative deprivation, resource mobilization, and social networks. Yet, factors vary by location, event, and the individuals involved. It is impossible to explain all the intricacies surrounding the mobilization of actors for collective political violence. However, I will identify some of the factors affecting the participation of individuals in state-mass killings. Theories of relative deprivation often site inequalities as an important foundation for collective violence. Certainly, national and local elites often manipulate religious, ethnic, and class conflicts in their struggles for power. Yet while social inequalities provide many opportunities to mobilize individuals against perceived threats, the interaction of other situational and social processes is also necessary. Historically, the factors that make â€Å"a collectivity mobilizable for political purposes are overwhelmingly communal, however much this basis of common identity may be overlaid with ethnicity, religion, class consciousness, or some other loyalty†. By creating a sense of solidarity 5on regional and national levels, religious and nationalist ideologies may be used in order to mobilize the support and participation of larger collectivities. At event-specific levels, episodes of collective political violence create environments where solidarity is formed and reinforced . The common involvement of youth organizations highlights the importance of event-level in-group processes such as solidarity and group status formation. When understanding communal violence especially, â€Å"interactions that take place within the group of perpetrators may be more relevant† than those at the national or local political level. In environments stressing masculinity and physical strength, conflicts present opportunities for young males to establish themselves within social hierarchies. In such instances, group processes interact creating violence with imploding rather than exploding forces. While these processes are present in episodes of state-mass killings, such events must be understood separately. Participants in state organized mass violence are mobilized to varying degrees by terror. In-group processes are certainly important. Yet, the lack of information and the impossibility of observation create problems for analysis. In-group processes occur within a nd are affected by local and national contexts. Resource mobilization theories suggest that perceived opportunity also influence the mobilization of actors. While perceived threats may unite actors, perceived opportunities to reduce threats will motivate action. Based on theories of rational-choice, this concept suggests that actors calculate the cost and incentives of action. Participants in mass-killings and communal violence may not consciously think in terms of cost-benefit analysis. Most likely perceptions of risks interact with other in-group and out-group processes. However, rational assessments of future costs and benefits directly affect the decisions of most national and local leaders. Mobilization factors are extremely complex and vary by actor, level of analysis, and situation. I attempt to identify some of the 6variables affecting the mobilization of various actors within state-mass killings. State Mass Killings: Java and BaliOn September 30, 1965, six Indonesian generals were killed in an attempted military coup. The result of intra-military conflict during a time of national financial and political crisis, the coup is generally blamed on the PKI (Partai Komunis Indonesia). The mass killings in Indonesia 1965-66 were the direct result of a right-wing counter-coup, which centralized military control of the country under General Suharto. Within the national context, the killings served to repress opposition to General Suharto’s New Order by reconstructing society to correspond with a new basis of solidarity based on the military’s regime. In this sense, the killings can be understood as an ideological genocide due to the use of a â€Å"communist threat to justify a new design of state and society†. However, regional variations in the nature and extent of the killings complicate a typology, which emphasizes such a unifying ideology. This is partially re solved if variations are understood within a context of interacting national and local powershifts. Realignments of local military power occurred as Suharto solidified his position as leader of the new government in Java. Some regional commanders hesitated implementing the purge of local PKI members until Suharto’s victory was clear. In such cases, military units were sent to supervise and participate directly in the killings. However, the army relied on civilian vigilante gangs, whom they supplied with weapons and training to carry out the bulk of the killings. While affected by events from the center, local powershifts occurred within embedded regional conflicts. The military’s use of local cleavages to consolidate their power introduced an element of unpredictability. While this has motivated some to categorize the events as spontaneous, the majority of killings were premeditated and organized at national and local levels. 7The role of elite interests in the 1965-66 killings must be analyzed on three levels: international, national, and local. Set during the Cold War, the United States. had significant interests in removing communist influence from Indonesia and was publicly supportive of the military counter-coup. While the United States may not have directly instigated the massacres, it supported them indirectly by providing communication equipment and as well as a list of PKI members. Nationally, the killings served the interests of General Suharto and the military by ensuring their power over the state apparatus and the wealth and prestige, which accompanies it. Specific local elite interests varied by region. In scope, the provinces of Central Java, East Java, and Bali suffered the worst of the killing. While the internal dynamics of local powershifts differed between the regions, there are general similarities. The PKI gathered its base mainly from rural areas and campaigned for land reform and a gainst corruption. For local elites, the suppression of the PKI removed political opposition and protected financial interests. .ucbc9e6d936b848b653a14cd0699a7831 , .ucbc9e6d936b848b653a14cd0699a7831 .postImageUrl , .ucbc9e6d936b848b653a14cd0699a7831 .centered-text-area { min-height: 80px; position: relative; } .ucbc9e6d936b848b653a14cd0699a7831 , .ucbc9e6d936b848b653a14cd0699a7831:hover , .ucbc9e6d936b848b653a14cd0699a7831:visited , .ucbc9e6d936b848b653a14cd0699a7831:active { border:0!important; } .ucbc9e6d936b848b653a14cd0699a7831 .clearfix:after { content: ""; display: table; clear: both; } .ucbc9e6d936b848b653a14cd0699a7831 { display: block; transition: background-color 250ms; webkit-transition: background-color 250ms; width: 100%; opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #95A5A6; } .ucbc9e6d936b848b653a14cd0699a7831:active , .ucbc9e6d936b848b653a14cd0699a7831:hover { opacity: 1; transition: opacity 250ms; webkit-transition: opacity 250ms; background-color: #2C3E50; } .ucbc9e6d936b848b653a14cd0699a7831 .centered-text-area { width: 100%; position: relative ; } .ucbc9e6d936b848b653a14cd0699a7831 .ctaText { border-bottom: 0 solid #fff; color: #2980B9; font-size: 16px; font-weight: bold; margin: 0; padding: 0; text-decoration: underline; } .ucbc9e6d936b848b653a14cd0699a7831 .postTitle { color: #FFFFFF; font-size: 16px; font-weight: 600; margin: 0; padding: 0; width: 100%; } .ucbc9e6d936b848b653a14cd0699a7831 .ctaButton { background-color: #7F8C8D!important; color: #2980B9; border: none; border-radius: 3px; box-shadow: none; font-size: 14px; font-weight: bold; line-height: 26px; moz-border-radius: 3px; text-align: center; text-decoration: none; text-shadow: none; width: 80px; min-height: 80px; background: url(https://artscolumbia.org/wp-content/plugins/intelly-related-posts/assets/images/simple-arrow.png)no-repeat; position: absolute; right: 0; top: 0; } .ucbc9e6d936b848b653a14cd0699a7831:hover .ctaButton { background-color: #34495E!important; } .ucbc9e6d936b848b653a14cd0699a7831 .centered-text { display: table; height: 80px; padding-left : 18px; top: 0; } .ucbc9e6d936b848b653a14cd0699a7831 .ucbc9e6d936b848b653a14cd0699a7831-content { display: table-cell; margin: 0; padding: 0; padding-right: 108px; position: relative; vertical-align: middle; width: 100%; } .ucbc9e6d936b848b653a14cd0699a7831:after { content: ""; display: block; clear: both; } READ: Unemployment EssayNationalist ideology provided Suharto a basis for justification of the mass killings. Portraying the attempted coup as a communist plot against the nation, Suharto forces â€Å"founded and justified the subsequent campaign to destroy the Communist Party†. Nation-wide propaganda campaigns depicting PKI members as traitors, morally depraved, and anti-religious also provided justification for military actions. Propaganda served dual functions, displacing blame and removing moral obligations. By holding all PKI members collectively guilty for the national crisis and attempted coup, the military also provided individuals with justification for their act ions. Depicting PKI members as depraved removed the victims from the perpetrators world of social obligation. Local organizations enforced such justification for violence. In Java and in Bali, local organizations such as the Muslim group, Nahdatul Ulama and the nationalist party PNI represented the purge as a â€Å"holy war†. This not only removed the targets from the8perpetrators moral obligation but also created religious obligations to participate in the killings. Organizations not only played a role in justifying but also coordinating the killings. The direct involvement of the military and local organizations was necessary to maintain the intensity and scope of the murders throughout the islands of Java and Bali. On Java as the armed forces began internal purges of leftist officers, Muslim youth groups and NU leaders initiated attacks on PKI members. In Bali, PNI-backed vigilante gangs and NU-affiliated Ansor youth gangs were armed and directed by the military to partici pate in arrest and execution operations. By allowing regional power conflicts and individual rivalries to affect the nature of the killing, the use of civilian groups disguises the importance of state objectives on the killings of 1965-66. It has leaded some to label them as spontaneous. Yet, the military’s role as instigator and its movements to direct the purges reveal the states importance. Together the participation of the military and local political and religious groups highlights the essential role of organizations in the mass killings. Organizations played a crucial role in mobilizing participants. The military, political party, and religious authorities played an active role in shaping and encouraging violent anti-communism based on existing religious ideas and cultural analogies. Further, violence became an acceptable solution for pre-existing conflicts, which were based on perceptions of relative deprivation and religious differences. The military provided the opportunity for the perpetrators to take revenge on and to profit from victims. Similarly, opportunity and risk assessment played a role in the military’s actions. Support from the United States removed the possibility for sanctions so that genocide became cost-free. The use of youth organizations highlights the importance of social networks and event-level in-group processes. The violence provided opportunities to establish oneself in a social hierarchy based on notions of power and masculinity. â€Å"The vigilantes of 91965-1966 were primarily yo ung men, eager to demonstrate their ‘courage’ and their sense of ‘revolutionary’ commitment†. The manipulation of such youthful enthusiasm provided a deadly force for the military’s project. The exploited by leaders of traditional institutions of communal responsibility and labor to motivate collective killing of the PKI presents further evidence of the importance of local ties. In addition to the many willing participants, the military and local organizations mobilized the involvement of many others through terror. The government’s campaign made it impossible to remain politically neutral. Participation in the killings provided direct evidence of support for Suharto’s New Order. Anyone refusing to comply with the murders was labeled guilty by association and suffered the same fate as PKI members. I have depicted how elite interests, methods of justification, organizations, and methods of mobilization worked within an interactive frame resulting in the state mass killings of Indonesia 1965-66. Yet, this framework cannot completely explain the events. For instance, why did so many people need to be killed? A full-scale genocide went beyond ensuring new national and local power positions or resolving individual personal or ideological conflicts. Understanding the killings as part of larger process of social reconstruction may help explain the mass violence. Within a context of national crisis, the PKI became the scapegoat for Indonesia’s political and financial ills. The military’s manipulation of cultural stories depicting threats of total destruction lead to a ‘purifying violence’, necessary for a new cycle of growth, peace, and prosperity. The killings represent a social purge in preparation for a reconstruction of society. Though the actual transfo rmation may have been more superficial, the process highlights the ability of the state manipulate aspects of culture in struggles for power. Constructing a framework with which to understand collective political violence, I have examined state mass killings in Indonesia 1965-66. Further studies applying such a frame to other incidents of collective political violence will determine its general applicability. To truly comprehend collective violence, one must understand such 10interactions within comparative framework analyzing specific situations. Can a framework be applied cross-nationally and to other forms of collective political violence? Certainly, situations and events are unique. However, understanding the necessary conditions for collective political violence could aid future preventive policies. The analysis of state mass killings in Indonesia shows the importance of opportunity. National and local leaders may use political violence when it is seen as cost-free. The international community has a role in creating costs to deter leaders form using violence in struggles for power, wealth, and prestige. People deserve an arena in which they can hold national leaders responsible for crimes against humanity. Currently, the skeletons for such organizations exist. Without the support of the most powerful nations, these organizations will remain ineffectual. To prevent tragic abuses of power, the people of the world must stand together and demand accountability for their leaders. 11BibliographyBibliography1. P. Brass, ‘the production of Hindu-Muslim violence in contemporary India’, O.Tornquist (ed), Political Violence: Indonesia and India in comparative perspective, 2000, pp. 3-14. Oslo: University of Oslo. 2. R. Cribb, The Indonesian Killings. Studies from Java and Bali, 1990, pp. 1-43. Clayton: Monash Papers on Southeast Asia. 3. D. Gilmartin, ‘Partition, Pakistan, and South Asian history: In search of a narrative’, Journal of Asian Studies, 57, 1998: pp. 1068-1095. 4. H. Fein, ‘Revolutionary and antirevolutionary genocides: A comparison of state murders in democratic Kampuchea, 1975 to 1979, and in Indonesia, 1965 to 1966’, Comparative Studies in Society and History, 35, 1992: pp. 769-823. 5. R. Hefner, The Political Economy of Mountain Java, 1990, pp. 193-227, Berkeley: University of California Press. 6. H.Schulte Nordholt, ‘A genealogy of violence’, , 2000, pp. 1-18. 7. G. Robinson, ‘The post-coup massacre in Bali’, in D. Lev R. McVey (eds), Making Indonesia, 1996, 118-143. Ithaca: Cornell Southeast Asia Program. 8. O. Verkaaik, Inside the Citadel. Fun, violence, and religious nationalism in Hyderabad, Pakistan, Ph.D. Thesis University of Amsterdam, 1999, pp. 22. 9. H. Waterman, ‘Reasons and reason: collective political activity in comparative and historical perspective, World Politics, v 33, n 41, 1981, pp. 554-589. Sociology Essays

Cockney Rhyming Slang

Cockney Rhyming Slang Cockney Rhyming Slang Cockney Rhyming Slang By Sharon Cockney Rhyming Slang has been moving around the world, thanks to the popularity of East End gangster movies such as Lock, Stock and Two Smoking Barrels and many others. Its a series of words and phrases used by Cockneys and other Londoners. Originally, a Cockney was someone born within the area where they could hear the bells of St Mary le Bow church in Cheapside, London. (This is known as being born within the sound of the Bow Bells). However, an increasingly mobile society means that this label applies to anyone with Cockney heritage or accent. Rhyming slang consists of replacing a word or phrase with another that rhymes with it. To make it more confusing, the rhyme may be hidden, so that theres no obvious link between the slang term and the original word or phrase. No one is quite sure where the slang originates. Some speculate that it was designed to help thieves speak without being understood by others after a crackdown on crime in the heart of London. Others suggest that market traders created the slang so they could discuss matters among themselves while securing a good deal from their customers. What is known is that Cockney rhyming slang is alive and well, with new phrases entering the lexicon all the time. Some phrases have entered common British speech and are used daily without any awareness of their Cockney origins. Examples include: use your loaf (loaf of bread = head) have a butchers (butchers hook = look) cobblers rubbish (cobblers awls = balls) porkies (pork pies = lies) donkeys (donkeys ears = years) Other traditional expressions which are perhaps less widespread include: apples (apples and pears = stairs) plates (plates of meat = feet) Barnet (Barnet Fair = hair) Boat race (= face) Trouble (trouble and strife = wife) Pony (pony and trap = crap) Adam and Eve (= believe) dog (dog and bone = phone) china (china plate = mate) Rosie (Rosie Lee = tea) rabbit (rabbit and pork = talk) whistle (whistle and flute= suit) bacons (bacon and eggs = legs) cream crackered (= knackered tired) minces (mince pies = eyes) tea leaf (= thief) jimmy (Jimmy Riddle = piddle pee) The Cockney Rhyming Slang site also lists several examples of modern slang expressions, including: Ayrton (Ayrton Senna = tenner ten pound note) A la mode (= code) Anneka Rice ( = advice) Adrian Mole (= dole unemployment benefit) Abergavenny (= penny) These are just a few examples. The BBC provides a long list of Cockney Rhyming Slangand theres another extensive list here. Want to improve your English in five minutes a day? Get a subscription and start receiving our writing tips and exercises daily! Keep learning! Browse the Expressions category, check our popular posts, or choose a related post below:Compared "to" or Compared "with"?8 Writing Tips for Beginners10 Types of Hyphenation Errors

Analyzing Annual Reports of Two Canadian Banks to Determine Career and Essay

Analyzing Annual Reports of Two Canadian Banks to Determine Career and Investment Opportunities - Essay Example Basically, the companies are managed by directors on behalf of the shareholders and therefore have to be accountable to them. The annual report is a tool of communication by the directors and senior management to their shareholders explaining their business strategy of the previous year and explains their performance and also provides their vision for the company for the long term. It gives the shareholders the basis to critique and evaluate the effectiveness of their directors and also give input on what they expect from them. The annual report would also help to promote the agenda of the stakeholders internal, connected or external in a manner that would result in a win - win scenario. The two banks were selected randomly because they are among the largest financial institutions in Canada and have a long history of above average performance. They are therefore expected to have proper business models and offer an excellent career opportunity. Objectives In this analysis of the annual reports of TD and CIBC the writer is attempting to compare the two banks as investments and career opportunities. To begin with when an evaluation of the suitability of a bank as an investment opportunity there basic criteria include the profitability growth, level of liquidity and the capital structure of the company. The valuation of the company’s share and the performance in the stock market is also an indicator of the confidence the market has on the company. If a company has good profit history, a stable dividend growth policy and well managed working capital to ensure there are no liquidity problems would be the most attractive as an investment.

Leadership Essay Example | Topics and Well Written Essays - 250 words - 23

Leadership - Essay Example The nurses on very few occasions question the directives given by the doctors. The relationship between the doctor and the nurse functions adequately based on the principles of transactional leadership. My aunt is a registered nurse. I often talk to her and she has explained to me that the doctors have all the power in a hospital setting. To a certain degree nurses must always comply with eth directives of the doctors. The doctors are the ones ultimately responsible for the well being of the patients. The use of transactional leadership is customary in the hospitals since the doctors give the nurses instructions and mandates on how to take care of the patients. If anything goes wrong during the treatment the nurses are not as liable as the doctors, thus this is probably one of the reasons doctors are so strict in their mandates. A doctor’s license is worth millions of dollars over the lifetime of a doctor. Transactional leadership is the most effective way for doctors to interact with

Girl Interrupted Movie Review Example | Topics and Well Written Essays - 500 words

Girl Interrupted - Movie Review Example As the story progresses, Susanna became attached to Lisa who influenced her to cause troubles with the other patients. There was even a point where Susanna rejected the idea that she wasn't sick as what her boyfriend had told her because she relied much on Lisa. Susanna only came to realize how dangerous Lisa's personality was after Daisy killed herself and Lisa showed no mercy. Lisa even attacked Susanna and threatened to kill herself, too. At the end of the movie, Susanna was released from the institution. She left a remarkable line "Crazy isn't about being broken, or swallowing a dark secret. It's you, or me, amplified...". According to a study conducted by World Health Organization (2010) depression, anxiety, psychological distress, sexual violence, domestic violence and escalating rates of substance use affect women to a greater extent than men across different countries and different settings.

A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831,  rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.  The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly

“Inventing Elliot” the Final Chapter

Spilling the whole story was easier than Elliot thought It would be. Not even for a single second did he feel bad about what he was doing. Elliot was changing again, but this time for the better, and he could see his old self again. As he came to a close, he finally looked up at the principal. He wasn't sure how to react to his expression of utter disappointment so he simply got up and left. The principle needed time to take In everything Elliot Just said and he had other things he needed to do. Next It was time for Elliot to take care of the yellow paper.Not many kids were In school yet so he stood alone at the bulletin board. As he looked at the yellow paper, images of Ben and the outside bathroom flashed through his mind. The pain he felt for Ben was overwhelming him. He quickly tore down the paper, flipped it over to the back side and let his pen move across it. â€Å"It's was all it read. Now he needed to make things right with Louise, and if he couldn't do that he at least nee ded to tell her the truth. And that's exactly what he did. He caught her leaving the library and she wasn't too enthused to see him.He told her the whole story similar to the way he told the principal, leaving out nothing, but this time he added in why he did that, how he felt when he did it, and what he really wanted to do, but couldn't. Some way through the conversation, he saw her eyes gradually perk up to something like the way they were before. He knew she wasn't ready to forgive and forget, but he also knew some sort of happiness was igniting inside her because she finally had the truth. It felt right to tell Louise everything because maybe now when they restart, their relationship wont eave to revolve around lies; Elitist's life won't have to revolve around lies.But Elliot still wasn't done with his honesty rampage. Finally he went home to confess to the last and probably most important person, his mother. She so desperately tried to help him, but he pushed her away until she had no idea who he was anymore. Elliot was ready to fix things. It was hard for him to understand how his mother could still love him after all the horrible things he did, but she did and always would. He was surprised to find her home already, but she said nothing as he walked In. Elliot sat own, somehow different than the last time his mother saw him, and she recognized that.Elliot was no longer the Elliot with the Guardians, the Elliot with Louise, the Elliot with Ben, or the Elliot at home. There was only one Elliot now. Elliot Sutton. And that was the only Elliot he ever needed to be. They were both quiet for a moment, and then Elliot whispered something, â€Å"Mom†¦ I think I'm ready to talk now. † And finally, Elliot Sutton took off his last mask. â€Å"Inventing Elliot† the Final Chapter By catastrophes early. Is there something I can do for you? † Before he answered Elliot walked in and kook of indifference and went deep, deep inside himself and pu lled out the old Elliot, down.Spilling the whole story was easier than Elliot thought it would be. Not even for in everything Elliot Just said and he had other things he needed to do. Next it was time for Elliot to take care of the yellow paper. Not many kids were in school yet so he and let his pen move across it. â€Å"It's over† was all it read. Now he needed to make Louise everything because maybe now when they restart, their relationship won't surprised to find her home already, but she said nothing as he walked in. Elliot sat

Lab Report on Density Measurement

INTRODUCTION 1. 1 Background of the Experiment Mass density describes how heavy an object is. Defined by the Greek letter ? , read as rho, density is a basic yet important physical property of matter. For a bulk body without accounting its existing pores and voids, density is represented by the ratio of its mass and volume. It is given by the equation ? = massvolume 1. The SI unit of density is kg/m3. However, its CGS units, g/cm3 or g/ mL, are the most commonly used ones in the laboratory. The conversion is given by 1 gcm3=1gmL=1000 kgm3 [1].The density of a homogeneous liquid is also defined by the amount of mass per unit volume. Liquid is usually confined in a container, so its volume is relative to the volume of its container [2]. There are various instruments that are used to accurately measure the density of substances; the most commonly used are the densitometers, pycnometer and hydrometers [3]. In this experiment, the density of selected liquid samples will be measured using a pycnometer. 1. 2 Objectives of the Experiment 1. To determine the density of low boiling point liquid samples by measuring their mass at controlled volume; 2. o determine the density of alumina by measuring the mass and volume of variously shaped alumina balls; and 3. to compare the density calculated from the given samples with the standard density at room temperature. 1. 3 Significance of the Experiment At the end of the experiment, the laboratory performer is expected to learn the following; 1. the density of selected liquids and material at a given temperature; and 2. the proper method of measuring the volume and consequently the density of irregularly shaped objects using water displacement method.REVIEW OF RELATED LITERATURE Density is one of the most important and commonly used physical properties of matter. It is an intrinsic property which is represented by the ratio of a matter’s mass to its volume [3]. Density was purportedly discovered by the Greek scientist Arc himedes in an unusual circumstance. According to stories, King Hiero of Syracuse asked Archimedes to determine whether his new crown is made of pure gold or not. It was seemingly impossible to identify the gold percentage that composed the crown because chemical analysis was still unstudied in those times.One day, when Archimedes was enjoying himself to a bath, he observed that the further he went down the tub, the lesser he weighed and the higher the water level rose up. He then came to the realization that he could determine the ratio of the mass of the crown and the volume of water displaced by the crown, and compare it to the value measured from the pure gold sample. Hence, density and the principle behind it were revealed [4]. Density is dependent on many factors, one of which is temperature. It specifically decreases with increasing temperature.This is because an object’s volume undergoes thermal expansion at increasing temperature while its mass remains unchanged. This results to a decrease in density [1]. When matter undergoes a transformation to a different phase, it undergoes an abrupt change in density. The transition of molecules of matter to a less random form, say from gas to liquid or from liquid to solid, causes a drastic increase in the density. However, there are substances which behave differently from this density-temperature relationship, by which one example is water. The greatest density achieved by water molecules are at 4Â °C.At temperatures higher or lower than 4Â °C, its density slowly decreases. This makes ice less dense than water, a property not commonly exhibited by other liquids [3]. METHODOLOGY 3. 1 Materials A. Pycnometer, 25-mL B. Graduated cylinder, 1000-mL C. Graduated cylinder, 250-mL D. Beaker, 250-mL E. Low boiling point liquids (acetone, 70% solution ethyl alcohol, 70% solution isopropyl alcohol), 30 mL F. Distilled water G. Two sets of alumina balls (small cylindrical, large cylindrical and large spherical bal ls) H. Analytical balance beam 3. 2 Determining the Mass of a 25-mL Liquid [5] A.Carefully clean and dry the pycnometer. B. Weigh the empty pycnometer and its stopper in the balance beam and record the mass. C. Fill the pycnometer with the liquid sample up to its brim, and insert the stopper carefully. Wipe off any excess fluid on the sides of the pycnometer with a clean cloth or tissue. D. Balance and record the mass of the filled pycnometer plus the stopper. E. Empty the contents of the pycnometer in a clean beaker. F. Make three trials for each liquid. 3. 3 Determining the Mass and Volume of Alumina Balls [5] A. Measure the mass of each alumina ball in the balance beam. B.Add distilled water to the graduated cylinder and record its initial volume. C. Carefully drop an alumina ball to the graduated cylinder and measure the new volume. Do this by slightly tilting the cylinder and gently sliding the ball to its side. D. Use the 250-mL graduated cylinder for small cylindrical alumina balls while the 1000-mL cylinder for the large cylindrical and spherical alumina balls. E. Do the same procedure for the two sets of alumina balls. 3. 4 Calculating the Density of Liquid [5] A. Calculate the mass of the liquid by computing the difference between the recorded mass of the pycnometer when empty and filled with liquid.B. Calculate the density of the liquid by dividing its obtained mass by the volume indicated on the pycnometer. C. Record and compare the resulting density of the liquid with the standard value at room temperature. 3. 5 Calculating the Density of Alumina Balls [5] A. Compute for the volume of the alumina balls by subtracting the initial volume from the final volume of water in the graduated cylinder. B. Calculate for the density of the alumina balls by dividing the measured mass by the volume. C. Record and compare the resulting density of the alumina balls with the standard value at room temperature. 3. Data and Analysis Table 1. The mass of the four 25- mL liquid samples measured in three trials Liquid| Volume (mL)| Mass (grams)| | | 1ST Trial| 2nd Trial| 3RD Trial| Water| 25. 0| 25. 244| 25. 348| 25. 359| Acetone| 25. 0| 20. 131| 20. 147| 20. 163| Ethyl Alcohol| 25. 0| 22. 313| 22. 330| 22. 337| Isopropyl Alcohol| 25. 0| 22. 025| 22. 035| 22. 049| Table 2. The volume and mass of the two sets of alumina balls Alumina Ball (based on Size)| Set 1| Set 2| | Volume (mL)| Mass (grams)| Volume (mL)| Mass (grams)| Small cylindrical| 2. 0| 5. 813| 2. 0| 5. 742| Large cylindrical| 8. 5| 24. 042| 9. 5| 23. 42| Large spherical| 10. 0| 22. 975| 9. 0| 19. 747| Table 3. Calculation of density of the four liquid samples Liquid| Density (grams/mL)| | 1st Trial| 2ND Trial| 3rd Trial| Water| 25. 244 ? 25 = 1. 00976| 25. 348 ? 25. 0 = 1. 01392| 25. 359 ? 25. 0 = 1. 01436| Acetone| 20. 131 ? 25. 0= 0. 80524| 20. 147 ? 25. 0 = 0. 80588| 20. 163 ? 25. 0 = 0. 80652| Ethyl Alcohol| 22. 313 ? 25. 0= 0. 89252| 22. 330 ? 25. 0= 0. 89320| 22. 337 ? 25. 0= 0. 89348| Isopropyl Alcohol| 22. 025 ? 25. 0= 0. 88100| 22. 035 ? 25. 0= 0. 88140| 22. 049 ? 25. 0= 0. 88196| Table 4. Calculation of density of the alumina ballsAlumina Ball (based on Size)| Density (grams/mL)| | Set 1| Set 2| Small cylindrical| 5. 813 ? 2. 0 = 2. 9065| 5. 742 ? 2. 0= 2. 8710| Large cylindrical| 24. 042 ? 8. 5= 2. 8285| 23. 942 ? 9. 5= 2. 5202| Large spherical| 22. 975 ? 10. 0= 2. 2975| 19. 747 ? 9. 0= 2. 1941| Table 5. The mean values of the density calculated from the four liquid samples Liquid| Mean Value (g/mL)| Water| 1. 00976 + 1. 01392 +1. 014363| =1. 01268| Acetone| 0. 80524 + 0. 80588 + 0. 806523| =0. 80588| Ethyl Alcohol| 0. 89252 + 0. 89320 + 0. 893483| =0. 89307| Isopropyl Alcohol| 0. 88100 + 0. 88140 + 0. 881963| =0. 8145| Table 6. The mean value of the density calculated for the alumina balls Alumina Ball (based on Size)| Mean Value (g/mL)| Small Cylindrical| 2. 9065 + 2. 87102| =2. 8888| Large Cylindrical| 2. 8285 + 2. 52022| =2. 6744| Large Spherical| 2. 2975 + 2. 19412| =2. 2458| Average| 2. 8888 + 2. 6744 + 2. 24583| =2. 6027| RESULTS AND DISCUSSIONS The table below shows the obtained densities of the samples in four decimal places. Table 7. Summary of experimental densities of the samples Liquid/Material| Density (g/mL) at 25Â °C| Acetone| 0. 8059| Alumina| 2. 6027| Ethyl Alcohol| 0. 8931|Isopropyl Alcohol| 0. 8815| Water| 1. 0127| Table 8. Accepted values of the density of certain materials at 25Â °C [6] Liquid/Material| Standard Density (g/mL) at 25Â °C| Acetone| 0. 7846| Alumina| 2. 7300| Ethyl Alcohol| 0. 8651| Isopropyl Alcohol| 0. 8493| Water| 0. 9970| Accuracy of the result, or the agreement of the experimental value to the accepted value, is defined by its percentage error. An experimental result with a percentage error less than 5% is considered to be accurate. This indicates that the laboratory procedure performed in obtaining the said result is scientifically reliable [7].The next table shows the calculation of t he percentage errors of the densities obtained from the experiment relative to the accepted values represented in Table 8. Table 9. Calculation of the percentage error of the experimental densities of the samples Liquid/Material| | Acetone | 0. 7846 — 0. 80590. 7846| ? 100 = 2. 643%| Alumina| 2. 7300 — 2. 60272. 7300| ? 100 = 4. 663%| Ethyl Alcohol| 0. 8651— 0. 89310. 8651| ? 100 = 3. 237%| Isopropyl Alcohol| 0. 8493—- 0. 88150. 8493| ? 100 = 3. 791%| Water| 0. 9970 — 1. 01270. 9970| ? 100 = 1. 550%|Table 9 shows the percentage errors of the experimental densities computed from the samples. The values indicate that the experimental densities of acetone, alumina, ethyl alcohol, isopropyl alcohol and water at 25Â °C are within 5% error from accepted values, thereby implying that these results are accurate and the procedure used in performing the experiment is correct, consistent and reliable. Small disagreements in the values of experimental and acc epted densities can be accounted to factors that could slightly change the density of a material, in which one of these is temperature.The actual room temperature was not actually measured due to personal negligence, and was just assumed to be 25Â °C. Thus, the standard values that are used to compare with the results might be not be the most appropriate ones relative to temperature. Other factors which could lead to slight discrepancies in density could be the unavoidable systematic errors, particularly instrumental and human errors. CONCLUSION AND RECOMMENDATION In general, the experimental densities of all the samples used are significantly close to the standard densities at 25Â °C. Thus, the laboratory rocedure was done correctly and consistently. Small deviations of the results from the accepted values might be due to systematic errors. One of which can be caused by the lack of precision of the analytical balance beam. Human errors such as incorrect or inconsistent readings a nd interpretations of results might also cause these slight disagreements between the standard and experimental values. It is recommended to future laboratory performers to measure the actual room temperature before, while and after conducting the same experiment, to make sure that the temperature is constant all throughout.Temperature is a vital factor that could affect the results of the experiment. Hence, this must not be neglected. Nevertheless, the method of using pycnometer to measure the density of the liquids and water displacement method for the irregularly shaped solids yields accurate and reliable results. REFERENCES 1. Gallova, J. (2006). Density determination by pycnometer. Retrieved July 8, 2012 from Comenius University of Bratislava at http://www. fpharm. uniba. sk/fileadmin /user_upload/english/Fyzika/Density_determination_by_pycnometer. pdf 2.University of Massachusetts Boston, College of Science and Mathematics (2005). Measurement of Density and Archimedes’ Principle. Retrieved July 4, 2012 from http://www. physicslabs. umb. edu/Physics/sum07/181_Exp9_Sum07. 3. Johnston, J. (2011). Density Definition. Retrieved July 7, 2012 from http://www. densitydefinition. com/# 4. Bell, E. T. (1937). The mathematical achievements and methodologies of Archimedes [Electronic version]. Men of mathematics. Retrieved July 8, 2012 from http://mathdb. org/articles/archimedes/e_archimedes. htm#Bk03 5. Skyline College, Chemistry 210 Laboratory Manual (2010).Determination of the density of water and unknown solid sample. Retrieved July 7, 2012 from http://www. smccd. edu/accounts/batesa/chem210/lab/labmanual/Density2010. pdf 6. Walker, R. (1998). Density of Materials. Retrieved July 8, 2012 from http://www. simetric. co. uk/index. htm 7. Brooks P. R. , Curl R. F. , Weisman R. B. (1992). Investigating the relationship between the mass of a liquid and its volume [Electronic version]. Introductory Quantitative. pages 16-19. Retrieved July 8, 2012 from http://ww w. terrificscience. org/lessonpdfs/MassVolumeofLiquid. pdf