Cockney Rhyming Slang

Cockney Rhyming Slang Cockney Rhyming Slang Cockney Rhyming Slang By Sharon Cockney Rhyming Slang has been moving around the world, thanks to the popularity of East End gangster movies such as Lock, Stock and Two Smoking Barrels and many others. Its a series of words and phrases used by Cockneys and other Londoners. Originally, a Cockney was someone born within the area where they could hear the bells of St Mary le Bow church in Cheapside, London. (This is known as being born within the sound of the Bow Bells). However, an increasingly mobile society means that this label applies to anyone with Cockney heritage or accent. Rhyming slang consists of replacing a word or phrase with another that rhymes with it. To make it more confusing, the rhyme may be hidden, so that theres no obvious link between the slang term and the original word or phrase. No one is quite sure where the slang originates. Some speculate that it was designed to help thieves speak without being understood by others after a crackdown on crime in the heart of London. Others suggest that market traders created the slang so they could discuss matters among themselves while securing a good deal from their customers. What is known is that Cockney rhyming slang is alive and well, with new phrases entering the lexicon all the time. Some phrases have entered common British speech and are used daily without any awareness of their Cockney origins. Examples include: use your loaf (loaf of bread = head) have a butchers (butchers hook = look) cobblers rubbish (cobblers awls = balls) porkies (pork pies = lies) donkeys (donkeys ears = years) Other traditional expressions which are perhaps less widespread include: apples (apples and pears = stairs) plates (plates of meat = feet) Barnet (Barnet Fair = hair) Boat race (= face) Trouble (trouble and strife = wife) Pony (pony and trap = crap) Adam and Eve (= believe) dog (dog and bone = phone) china (china plate = mate) Rosie (Rosie Lee = tea) rabbit (rabbit and pork = talk) whistle (whistle and flute= suit) bacons (bacon and eggs = legs) cream crackered (= knackered tired) minces (mince pies = eyes) tea leaf (= thief) jimmy (Jimmy Riddle = piddle pee) The Cockney Rhyming Slang site also lists several examples of modern slang expressions, including: Ayrton (Ayrton Senna = tenner ten pound note) A la mode (= code) Anneka Rice ( = advice) Adrian Mole (= dole unemployment benefit) Abergavenny (= penny) These are just a few examples. The BBC provides a long list of Cockney Rhyming Slangand theres another extensive list here. Want to improve your English in five minutes a day? Get a subscription and start receiving our writing tips and exercises daily! Keep learning! Browse the Expressions category, check our popular posts, or choose a related post below:Compared "to" or Compared "with"?8 Writing Tips for Beginners10 Types of Hyphenation Errors

Analyzing Annual Reports of Two Canadian Banks to Determine Career and Essay

Analyzing Annual Reports of Two Canadian Banks to Determine Career and Investment Opportunities - Essay Example Basically, the companies are managed by directors on behalf of the shareholders and therefore have to be accountable to them. The annual report is a tool of communication by the directors and senior management to their shareholders explaining their business strategy of the previous year and explains their performance and also provides their vision for the company for the long term. It gives the shareholders the basis to critique and evaluate the effectiveness of their directors and also give input on what they expect from them. The annual report would also help to promote the agenda of the stakeholders internal, connected or external in a manner that would result in a win - win scenario. The two banks were selected randomly because they are among the largest financial institutions in Canada and have a long history of above average performance. They are therefore expected to have proper business models and offer an excellent career opportunity. Objectives In this analysis of the annual reports of TD and CIBC the writer is attempting to compare the two banks as investments and career opportunities. To begin with when an evaluation of the suitability of a bank as an investment opportunity there basic criteria include the profitability growth, level of liquidity and the capital structure of the company. The valuation of the company’s share and the performance in the stock market is also an indicator of the confidence the market has on the company. If a company has good profit history, a stable dividend growth policy and well managed working capital to ensure there are no liquidity problems would be the most attractive as an investment.

Leadership Essay Example | Topics and Well Written Essays - 250 words - 23

Leadership - Essay Example The nurses on very few occasions question the directives given by the doctors. The relationship between the doctor and the nurse functions adequately based on the principles of transactional leadership. My aunt is a registered nurse. I often talk to her and she has explained to me that the doctors have all the power in a hospital setting. To a certain degree nurses must always comply with eth directives of the doctors. The doctors are the ones ultimately responsible for the well being of the patients. The use of transactional leadership is customary in the hospitals since the doctors give the nurses instructions and mandates on how to take care of the patients. If anything goes wrong during the treatment the nurses are not as liable as the doctors, thus this is probably one of the reasons doctors are so strict in their mandates. A doctor’s license is worth millions of dollars over the lifetime of a doctor. Transactional leadership is the most effective way for doctors to interact with

Girl Interrupted Movie Review Example | Topics and Well Written Essays - 500 words

Girl Interrupted - Movie Review Example As the story progresses, Susanna became attached to Lisa who influenced her to cause troubles with the other patients. There was even a point where Susanna rejected the idea that she wasn't sick as what her boyfriend had told her because she relied much on Lisa. Susanna only came to realize how dangerous Lisa's personality was after Daisy killed herself and Lisa showed no mercy. Lisa even attacked Susanna and threatened to kill herself, too. At the end of the movie, Susanna was released from the institution. She left a remarkable line "Crazy isn't about being broken, or swallowing a dark secret. It's you, or me, amplified...". According to a study conducted by World Health Organization (2010) depression, anxiety, psychological distress, sexual violence, domestic violence and escalating rates of substance use affect women to a greater extent than men across different countries and different settings.

A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831,  rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.  The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly

“Inventing Elliot” the Final Chapter

Spilling the whole story was easier than Elliot thought It would be. Not even for a single second did he feel bad about what he was doing. Elliot was changing again, but this time for the better, and he could see his old self again. As he came to a close, he finally looked up at the principal. He wasn't sure how to react to his expression of utter disappointment so he simply got up and left. The principle needed time to take In everything Elliot Just said and he had other things he needed to do. Next It was time for Elliot to take care of the yellow paper.Not many kids were In school yet so he stood alone at the bulletin board. As he looked at the yellow paper, images of Ben and the outside bathroom flashed through his mind. The pain he felt for Ben was overwhelming him. He quickly tore down the paper, flipped it over to the back side and let his pen move across it. â€Å"It's was all it read. Now he needed to make things right with Louise, and if he couldn't do that he at least nee ded to tell her the truth. And that's exactly what he did. He caught her leaving the library and she wasn't too enthused to see him.He told her the whole story similar to the way he told the principal, leaving out nothing, but this time he added in why he did that, how he felt when he did it, and what he really wanted to do, but couldn't. Some way through the conversation, he saw her eyes gradually perk up to something like the way they were before. He knew she wasn't ready to forgive and forget, but he also knew some sort of happiness was igniting inside her because she finally had the truth. It felt right to tell Louise everything because maybe now when they restart, their relationship wont eave to revolve around lies; Elitist's life won't have to revolve around lies.But Elliot still wasn't done with his honesty rampage. Finally he went home to confess to the last and probably most important person, his mother. She so desperately tried to help him, but he pushed her away until she had no idea who he was anymore. Elliot was ready to fix things. It was hard for him to understand how his mother could still love him after all the horrible things he did, but she did and always would. He was surprised to find her home already, but she said nothing as he walked In. Elliot sat own, somehow different than the last time his mother saw him, and she recognized that.Elliot was no longer the Elliot with the Guardians, the Elliot with Louise, the Elliot with Ben, or the Elliot at home. There was only one Elliot now. Elliot Sutton. And that was the only Elliot he ever needed to be. They were both quiet for a moment, and then Elliot whispered something, â€Å"Mom†¦ I think I'm ready to talk now. † And finally, Elliot Sutton took off his last mask. â€Å"Inventing Elliot† the Final Chapter By catastrophes early. Is there something I can do for you? † Before he answered Elliot walked in and kook of indifference and went deep, deep inside himself and pu lled out the old Elliot, down.Spilling the whole story was easier than Elliot thought it would be. Not even for in everything Elliot Just said and he had other things he needed to do. Next it was time for Elliot to take care of the yellow paper. Not many kids were in school yet so he and let his pen move across it. â€Å"It's over† was all it read. Now he needed to make Louise everything because maybe now when they restart, their relationship won't surprised to find her home already, but she said nothing as he walked in. Elliot sat

Lab Report on Density Measurement

INTRODUCTION 1. 1 Background of the Experiment Mass density describes how heavy an object is. Defined by the Greek letter ? , read as rho, density is a basic yet important physical property of matter. For a bulk body without accounting its existing pores and voids, density is represented by the ratio of its mass and volume. It is given by the equation ? = massvolume 1. The SI unit of density is kg/m3. However, its CGS units, g/cm3 or g/ mL, are the most commonly used ones in the laboratory. The conversion is given by 1 gcm3=1gmL=1000 kgm3 [1].The density of a homogeneous liquid is also defined by the amount of mass per unit volume. Liquid is usually confined in a container, so its volume is relative to the volume of its container [2]. There are various instruments that are used to accurately measure the density of substances; the most commonly used are the densitometers, pycnometer and hydrometers [3]. In this experiment, the density of selected liquid samples will be measured using a pycnometer. 1. 2 Objectives of the Experiment 1. To determine the density of low boiling point liquid samples by measuring their mass at controlled volume; 2. o determine the density of alumina by measuring the mass and volume of variously shaped alumina balls; and 3. to compare the density calculated from the given samples with the standard density at room temperature. 1. 3 Significance of the Experiment At the end of the experiment, the laboratory performer is expected to learn the following; 1. the density of selected liquids and material at a given temperature; and 2. the proper method of measuring the volume and consequently the density of irregularly shaped objects using water displacement method.REVIEW OF RELATED LITERATURE Density is one of the most important and commonly used physical properties of matter. It is an intrinsic property which is represented by the ratio of a matter’s mass to its volume [3]. Density was purportedly discovered by the Greek scientist Arc himedes in an unusual circumstance. According to stories, King Hiero of Syracuse asked Archimedes to determine whether his new crown is made of pure gold or not. It was seemingly impossible to identify the gold percentage that composed the crown because chemical analysis was still unstudied in those times.One day, when Archimedes was enjoying himself to a bath, he observed that the further he went down the tub, the lesser he weighed and the higher the water level rose up. He then came to the realization that he could determine the ratio of the mass of the crown and the volume of water displaced by the crown, and compare it to the value measured from the pure gold sample. Hence, density and the principle behind it were revealed [4]. Density is dependent on many factors, one of which is temperature. It specifically decreases with increasing temperature.This is because an object’s volume undergoes thermal expansion at increasing temperature while its mass remains unchanged. This results to a decrease in density [1]. When matter undergoes a transformation to a different phase, it undergoes an abrupt change in density. The transition of molecules of matter to a less random form, say from gas to liquid or from liquid to solid, causes a drastic increase in the density. However, there are substances which behave differently from this density-temperature relationship, by which one example is water. The greatest density achieved by water molecules are at 4Â °C.At temperatures higher or lower than 4Â °C, its density slowly decreases. This makes ice less dense than water, a property not commonly exhibited by other liquids [3]. METHODOLOGY 3. 1 Materials A. Pycnometer, 25-mL B. Graduated cylinder, 1000-mL C. Graduated cylinder, 250-mL D. Beaker, 250-mL E. Low boiling point liquids (acetone, 70% solution ethyl alcohol, 70% solution isopropyl alcohol), 30 mL F. Distilled water G. Two sets of alumina balls (small cylindrical, large cylindrical and large spherical bal ls) H. Analytical balance beam 3. 2 Determining the Mass of a 25-mL Liquid [5] A.Carefully clean and dry the pycnometer. B. Weigh the empty pycnometer and its stopper in the balance beam and record the mass. C. Fill the pycnometer with the liquid sample up to its brim, and insert the stopper carefully. Wipe off any excess fluid on the sides of the pycnometer with a clean cloth or tissue. D. Balance and record the mass of the filled pycnometer plus the stopper. E. Empty the contents of the pycnometer in a clean beaker. F. Make three trials for each liquid. 3. 3 Determining the Mass and Volume of Alumina Balls [5] A. Measure the mass of each alumina ball in the balance beam. B.Add distilled water to the graduated cylinder and record its initial volume. C. Carefully drop an alumina ball to the graduated cylinder and measure the new volume. Do this by slightly tilting the cylinder and gently sliding the ball to its side. D. Use the 250-mL graduated cylinder for small cylindrical alumina balls while the 1000-mL cylinder for the large cylindrical and spherical alumina balls. E. Do the same procedure for the two sets of alumina balls. 3. 4 Calculating the Density of Liquid [5] A. Calculate the mass of the liquid by computing the difference between the recorded mass of the pycnometer when empty and filled with liquid.B. Calculate the density of the liquid by dividing its obtained mass by the volume indicated on the pycnometer. C. Record and compare the resulting density of the liquid with the standard value at room temperature. 3. 5 Calculating the Density of Alumina Balls [5] A. Compute for the volume of the alumina balls by subtracting the initial volume from the final volume of water in the graduated cylinder. B. Calculate for the density of the alumina balls by dividing the measured mass by the volume. C. Record and compare the resulting density of the alumina balls with the standard value at room temperature. 3. Data and Analysis Table 1. The mass of the four 25- mL liquid samples measured in three trials Liquid| Volume (mL)| Mass (grams)| | | 1ST Trial| 2nd Trial| 3RD Trial| Water| 25. 0| 25. 244| 25. 348| 25. 359| Acetone| 25. 0| 20. 131| 20. 147| 20. 163| Ethyl Alcohol| 25. 0| 22. 313| 22. 330| 22. 337| Isopropyl Alcohol| 25. 0| 22. 025| 22. 035| 22. 049| Table 2. The volume and mass of the two sets of alumina balls Alumina Ball (based on Size)| Set 1| Set 2| | Volume (mL)| Mass (grams)| Volume (mL)| Mass (grams)| Small cylindrical| 2. 0| 5. 813| 2. 0| 5. 742| Large cylindrical| 8. 5| 24. 042| 9. 5| 23. 42| Large spherical| 10. 0| 22. 975| 9. 0| 19. 747| Table 3. Calculation of density of the four liquid samples Liquid| Density (grams/mL)| | 1st Trial| 2ND Trial| 3rd Trial| Water| 25. 244 ? 25 = 1. 00976| 25. 348 ? 25. 0 = 1. 01392| 25. 359 ? 25. 0 = 1. 01436| Acetone| 20. 131 ? 25. 0= 0. 80524| 20. 147 ? 25. 0 = 0. 80588| 20. 163 ? 25. 0 = 0. 80652| Ethyl Alcohol| 22. 313 ? 25. 0= 0. 89252| 22. 330 ? 25. 0= 0. 89320| 22. 337 ? 25. 0= 0. 89348| Isopropyl Alcohol| 22. 025 ? 25. 0= 0. 88100| 22. 035 ? 25. 0= 0. 88140| 22. 049 ? 25. 0= 0. 88196| Table 4. Calculation of density of the alumina ballsAlumina Ball (based on Size)| Density (grams/mL)| | Set 1| Set 2| Small cylindrical| 5. 813 ? 2. 0 = 2. 9065| 5. 742 ? 2. 0= 2. 8710| Large cylindrical| 24. 042 ? 8. 5= 2. 8285| 23. 942 ? 9. 5= 2. 5202| Large spherical| 22. 975 ? 10. 0= 2. 2975| 19. 747 ? 9. 0= 2. 1941| Table 5. The mean values of the density calculated from the four liquid samples Liquid| Mean Value (g/mL)| Water| 1. 00976 + 1. 01392 +1. 014363| =1. 01268| Acetone| 0. 80524 + 0. 80588 + 0. 806523| =0. 80588| Ethyl Alcohol| 0. 89252 + 0. 89320 + 0. 893483| =0. 89307| Isopropyl Alcohol| 0. 88100 + 0. 88140 + 0. 881963| =0. 8145| Table 6. The mean value of the density calculated for the alumina balls Alumina Ball (based on Size)| Mean Value (g/mL)| Small Cylindrical| 2. 9065 + 2. 87102| =2. 8888| Large Cylindrical| 2. 8285 + 2. 52022| =2. 6744| Large Spherical| 2. 2975 + 2. 19412| =2. 2458| Average| 2. 8888 + 2. 6744 + 2. 24583| =2. 6027| RESULTS AND DISCUSSIONS The table below shows the obtained densities of the samples in four decimal places. Table 7. Summary of experimental densities of the samples Liquid/Material| Density (g/mL) at 25Â °C| Acetone| 0. 8059| Alumina| 2. 6027| Ethyl Alcohol| 0. 8931|Isopropyl Alcohol| 0. 8815| Water| 1. 0127| Table 8. Accepted values of the density of certain materials at 25Â °C [6] Liquid/Material| Standard Density (g/mL) at 25Â °C| Acetone| 0. 7846| Alumina| 2. 7300| Ethyl Alcohol| 0. 8651| Isopropyl Alcohol| 0. 8493| Water| 0. 9970| Accuracy of the result, or the agreement of the experimental value to the accepted value, is defined by its percentage error. An experimental result with a percentage error less than 5% is considered to be accurate. This indicates that the laboratory procedure performed in obtaining the said result is scientifically reliable [7].The next table shows the calculation of t he percentage errors of the densities obtained from the experiment relative to the accepted values represented in Table 8. Table 9. Calculation of the percentage error of the experimental densities of the samples Liquid/Material| | Acetone | 0. 7846 — 0. 80590. 7846| ? 100 = 2. 643%| Alumina| 2. 7300 — 2. 60272. 7300| ? 100 = 4. 663%| Ethyl Alcohol| 0. 8651— 0. 89310. 8651| ? 100 = 3. 237%| Isopropyl Alcohol| 0. 8493—- 0. 88150. 8493| ? 100 = 3. 791%| Water| 0. 9970 — 1. 01270. 9970| ? 100 = 1. 550%|Table 9 shows the percentage errors of the experimental densities computed from the samples. The values indicate that the experimental densities of acetone, alumina, ethyl alcohol, isopropyl alcohol and water at 25Â °C are within 5% error from accepted values, thereby implying that these results are accurate and the procedure used in performing the experiment is correct, consistent and reliable. Small disagreements in the values of experimental and acc epted densities can be accounted to factors that could slightly change the density of a material, in which one of these is temperature.The actual room temperature was not actually measured due to personal negligence, and was just assumed to be 25Â °C. Thus, the standard values that are used to compare with the results might be not be the most appropriate ones relative to temperature. Other factors which could lead to slight discrepancies in density could be the unavoidable systematic errors, particularly instrumental and human errors. CONCLUSION AND RECOMMENDATION In general, the experimental densities of all the samples used are significantly close to the standard densities at 25Â °C. Thus, the laboratory rocedure was done correctly and consistently. Small deviations of the results from the accepted values might be due to systematic errors. One of which can be caused by the lack of precision of the analytical balance beam. Human errors such as incorrect or inconsistent readings a nd interpretations of results might also cause these slight disagreements between the standard and experimental values. It is recommended to future laboratory performers to measure the actual room temperature before, while and after conducting the same experiment, to make sure that the temperature is constant all throughout.Temperature is a vital factor that could affect the results of the experiment. Hence, this must not be neglected. Nevertheless, the method of using pycnometer to measure the density of the liquids and water displacement method for the irregularly shaped solids yields accurate and reliable results. REFERENCES 1. Gallova, J. (2006). Density determination by pycnometer. Retrieved July 8, 2012 from Comenius University of Bratislava at http://www. fpharm. uniba. sk/fileadmin /user_upload/english/Fyzika/Density_determination_by_pycnometer. pdf 2.University of Massachusetts Boston, College of Science and Mathematics (2005). Measurement of Density and Archimedes’ Principle. Retrieved July 4, 2012 from http://www. physicslabs. umb. edu/Physics/sum07/181_Exp9_Sum07. 3. Johnston, J. (2011). Density Definition. Retrieved July 7, 2012 from http://www. densitydefinition. com/# 4. Bell, E. T. (1937). The mathematical achievements and methodologies of Archimedes [Electronic version]. Men of mathematics. Retrieved July 8, 2012 from http://mathdb. org/articles/archimedes/e_archimedes. htm#Bk03 5. Skyline College, Chemistry 210 Laboratory Manual (2010).Determination of the density of water and unknown solid sample. Retrieved July 7, 2012 from http://www. smccd. edu/accounts/batesa/chem210/lab/labmanual/Density2010. pdf 6. Walker, R. (1998). Density of Materials. Retrieved July 8, 2012 from http://www. simetric. co. uk/index. htm 7. Brooks P. R. , Curl R. F. , Weisman R. B. (1992). Investigating the relationship between the mass of a liquid and its volume [Electronic version]. Introductory Quantitative. pages 16-19. Retrieved July 8, 2012 from http://ww w. terrificscience. org/lessonpdfs/MassVolumeofLiquid. pdf